Memory Nexus: Molecule 06

Art & Science project by Joanna Hoffmann developed with the ASN Team in the frame of the SPIN-FERT / Horizon Europe (Misson Soil) program

BAGECO 2025: Bacteria Drive Our Planet’s Health. The 17th International Symposium on Bacterial Genetics and Ecology (BAGECO) held between 01-04. July 2025, in Graz Austria, gathered 230 scientists from 37 countries to explore how bacteria shape planetary health, linking microbiomes, climate change, biodiversity, and human well-being. The BAGECO was opened with the “Breath of Soil: Memory Nexus,” a participatory action inviting attendees to smell the soil sample prepared by the TUG SPIN-FERT Team and record the memories it evoked. These recollections composes a RNA memory molecule — a poetic bridge between soil, science, and collective memory — setting a reflective and connective tone for the symposium.

The soil samples prepared by TU GRAZ SPIN-FERT Team were from an extensively managed grassland soil, with about 10^9 bacteria in one gram of soil. These bacteria belong to 3000 to 4000 different taxa, which (together) produce several hundred different volatile compounds. The soil contains many bacteria from the class Polyangia (https://www.gbif.org/occurrence/gallery?taxon_key=10701047), which are from the phylum Myxococcota (https://www.gbif.org/species/10814448) that are characterised by their distinct social lifestyles.

The Memory Molecule No. 6:

5'-GCGAUCUUCGGAUCGCAAAGGCAAGAAACUUUGCCAGGGUGGGUGGGUGGCCUUUAAAUAUUUCAUAUAAAAAAAACCCCCCCUUUCCCCCCCC -3'

Click on the circles to uncover the lingering echoes of the past.

RNA molecule, like DNA, is composed of four essential bases: adenine, cytosine, guanine and uracil ( denoted by the letters A, C, G and U ). Each RNA molecule folds into a unique shape, a structure dictated by the specific sequence and pairing of these bases.

Wonder (discovery, exploration, play) - Adenine
Safety ( belonging & affection) - Cytosine
Nostalgia & sensory echoes - Guanine
Work, soil studies and interactions - Uracil

samples of memories