Art & Science project being developed by Joanna Hoffmann with the ASN Team in the frame of the SPIN-FERT / Horizon Europe (Misson Soil) program
On Saturday, 25 April 2026, Prof. Eligio Malusa, with the SPIN-FERT team, held a Breath of Soil – Memory Nexus session at Earth Day (Giornata della Terra) in Torino, Italy
The event was organised on the occasion of World Earth Day in the wonderful King’s Palace Garden, in the heart of the city. It promoted the sustainable use of resources and the protection of biodiversity; thus, SPIN-FERT could not be absent from its quest for healthier, more biodiverse soil!
The information about the need to use plant growing substrates that do not contain (or that contain only a limited amount) of peat was funnelled toward the citizens who visited the event. The Breath of Soil – Memory Nexus was the activity that focused the participants’ attention on this topic, and their appreciation can be gauged by the large number of “Memories” we gathered in just a few hours.
Click on the circles to uncover the lingering echoes of the past.
This composition is built upon the intricate secondary structure of RNA, which, like DNA, is composed of four essential bases: adenine, uracil, cytosine, and guanine ( denoted by the letters A, U, C and G ). Each RNA molecule folds into a unique shape, a structure dictated by the specific sequence and pairing of these bases. The resulting shape is crucial, as it determines the RNA's function within the cell. 5′-CUCUUUCAAUAAUAUUUUUAGAAAUGGGCACUUCAUGAUCUUAAUAACUUCAAGGAUUUCCUAAAAACAUUAAUGCCUUCCAGAGUUUCAGAAGAAAACAUAUGACAGCGA-3′; ...((((.............)))).........(....((((...(((((.((((....................))))...)))))....))))........)....... |
