Memory Nexus: Molecule 05

Art & Science project being developed by Joanna Hoffmann with the ASN Team in the frame of the SPIN-FERT / Horizon Europe (Misson Soil) program

During the ECSITE 2025 Conference of the European Network of Science Centres and Museums, participants were invited to explore the intersections of human memory, olfactory perception, and soil ecology. 

Photos: ECSITE

The soil sample was prepared by SPIN-FERT scientists from ENOMONDO (IT) and InHORT (PL). For the sample, they used compost produced using an innovative method that combines wastes from agri-food industries. In particular, it included three kinds of raw materials: i)residues from wine production (grape pomace – formed of grape skin and seeds), after the extraction of the remaining alcohol (to produce grappa, the famous Italian distillate), ii) the residues from the transformation into preservatives or frozen food of fruits (apple pomace – the peel and exhausted flesh – from the production of juices) and vegetables (tomato or other vegetable peels), and iii) the material obtained from pruning grape vines (shoots and vines). These raw materials, characterised by high quality and free from plastics and other impurities, were processed using innovative composting technology, enabling them to be transformed into a pleasantly scented compost. Decay is a fundamental process in soil formation and maintenance. Composting is a form of controlled decay in which organic waste is managed to produce a nutrient-rich amendment for the soil.  Learn more about soil, its composition and smell

Our Memory Molecule coming soon!!!

Click on the circles to uncover the lingering echoes of the past.

This composition is built upon the intricate secondary structure of RNA, which, like DNA, is composed of four essential bases: adenine, uracil, cytosine, and guanine ( denoted by the letters A, U, C and G ). Each RNA molecule folds into a unique shape, a structure dictated by the specific sequence and pairing of these bases. The resulting shape is crucial, as it determines the RNA's function within the cell. The Memory Molecule No5: 5'- AAAUUUGCCGAUUCCGAAUUUCCCGGAUUU -3'

Wonder & Curiosity (Adenine)
Safety & Belonging(Uracil)
Nostalgia & Sensory Echoes (Cytosine)
Uncanny & Ambiguous (Guanine)
>